Review



downstream cccagttaatatgcaccgaa 3  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc downstream cccagttaatatgcaccgaa 3
    Downstream Cccagttaatatgcaccgaa 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 137 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12962108-284-18-18?v=Addgene+inc
    Average 95 stars, based on 137 article reviews
    downstream cccagttaatatgcaccgaa 3 - by Bioz Stars, 2026-07
    95/100 stars

    Images



    Similar Products

    downstream cccagttaatatgcaccgaa 3  (Addgene inc)
    95
    Addgene inc downstream cccagttaatatgcaccgaa 3
    Downstream Cccagttaatatgcaccgaa 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12962108-284-18-18?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    downstream cccagttaatatgcaccgaa 3 - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    pl crispr efs gfp vector  (Addgene inc)
    95
    Addgene inc pl crispr efs gfp vector
    Pl Crispr Efs Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12962108-284-16-18?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    pl crispr efs gfp vector - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    pl crispr efs gfp plasmid  (Addgene inc)
    95
    Addgene inc pl crispr efs gfp plasmid
    Pl Crispr Efs Gfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/bio_rxiv__64898__2026__02__24__707639-41-1-3?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    pl crispr efs gfp plasmid - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    pl crispr ef gfp  (Addgene inc)
    95
    Addgene inc pl crispr ef gfp
    Pl Crispr Ef Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12938759-43-6-7?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    pl crispr ef gfp - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    crispr efs gfp  (Addgene inc)
    95
    Addgene inc crispr efs gfp
    Crispr Efs Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12357098-92-0-6?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    crispr efs gfp - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    addgene plasmid  (Addgene inc)
    95
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pmc12357098-92-6-6?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    pl crispr efs gfp  (Addgene inc)
    95
    Addgene inc pl crispr efs gfp
    Pl Crispr Efs Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pl+crispr+efs+gfp/pm40846763-323-11-12?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    pl crispr efs gfp - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier

    Image Search Results